This database allows retrieval of precomputed tandem repeats from the selected genome. It also allows to easily design primers for amplification of a DNA fragment containing the tandem repeat. The primers may be used for PCR simulation with a specific genome or with all genomes within the selected genera.
Percentaje of mismatches allowed within the tandem repeats:
0 |
0.1 |
0.2
| Position | Sequence | |
| 178745 | GGTCCTTCAGGTCCTTCGGCTCCTTCAG | Design primers |
| 327446 | GGTGTAGGTGGAGGTGTAGGTGCAGGT | Design primers |
| 349266 | GTT-GTT-GTT-GCT-GTT-GCT-GTT-GCT-G | Design primers |
| 563211 | TTTAAATTTTTAAGTTTTTAAGTTTTT | Design primers |
| 599299 | CTTTTATTTTCTTTTTTTTTCCTTTC | Design primers |
| 845432 | GAA-GAT-GAA-AAT-GAA-GAT-GAT-GAT-GAG-GAT-G | Design primers |
| 1154323 | CGATAAAAATCGATAAAGAACGAGAAGAAT | Design primers |
| 1174131 | ATCTAAACCTAAATTTAAATCTATA | Design primers |
|
Please help us improve this resource by reporting problems, suggestions etc.