Sequence retrieval

Genome: Chlamydophila pneumoniae AR39
Start position: 327446
End position: 327472
Length: 27

DNA sequence
>NC_002179, from 327446 to 327472 (27 bp); Chlamydophila pneumoniae AR39 GGTGTAGGTGGAGGTGTAGGTGCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 325433-328420	Sequence	CP0299 - polymorphic membrane protein G family protein (Protein is coded in complementary strand; from 328420 to 325433)