Sequence retrieval

Genome: Chlamydophila pneumoniae AR39
Start position: 178745
End position: 178772
Length: 28

DNA sequence
>NC_002179, from 178745 to 178772 (28 bp); Chlamydophila pneumoniae AR39 GGTCCTTCAGGTCCTTCGGCTCCTTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 176966-179233	Sequence	CP0177 - hypothetical protein (Protein is coded in complementary strand; from 179233 to 176966)