Sequence retrieval

Genome: Chlamydophila pneumoniae AR39
Start position: 599299
End position: 599324
Length: 26

DNA sequence
>NC_002179, from 599299 to 599324 (26 bp); Chlamydophila pneumoniae AR39 CTTTTATTTTCTTTTTTTTTCCTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 599303-600247	Sequence	CP0568 - peptide ABC transporter permease (Protein is coded in complementary strand; from 600247 to 599303)