Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 875618
End position: 875644
Length: 27

DNA sequence
>NC_023150, from 875618 to 875644 (27 bp); Rhodococcus pyridinivorans SB3094 TAGCCGAGATAGCCGACATAGCCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 874442-876595	Sequence	Y013_04235 - para-aminobenzoate synthase (Protein is coded in complementary strand; from 876595 to 874442)