Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 867088
End position: 867111
Length: 24

DNA sequence
>NC_023150, from 867088 to 867111 (24 bp); Rhodococcus pyridinivorans SB3094 CCACCACCACGACCAGCAACACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 867051-867815	Sequence	Y013_04200 - membrane protein (Protein is coded in complementary strand; from 867815 to 867051)