Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 797329
End position: 797364
Length: 36

DNA sequence
>NC_023150, from 797329 to 797364 (36 bp); Rhodococcus pyridinivorans SB3094 TCGGCGCCGCCGTCGGCGCCCCCGTCGGCACCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 797221-797466	Sequence	Y013_03860 - BatC protein (Protein is coded in complementary strand; from 797466 to 797221)