Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 639155
End position: 639178
Length: 24

DNA sequence
>NC_023150, from 639155 to 639178 (24 bp); Rhodococcus pyridinivorans SB3094 CCGGTGCCGGTGCCGGTGCCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 638104-639264	Sequence	Y013_03040 - mannan endo-1,4-beta-mannosidase (Protein is coded in complementary strand; from 639264 to 638104)