Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 560257
End position: 560301
Length: 45

DNA sequence
>NC_023150, from 560257 to 560301 (45 bp); Rhodococcus pyridinivorans SB3094 CGCCGAACTCTTCGACGCCGAACTCTTCGACGCCGAACTCTTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 560132-561184	Sequence	Y013_02700 - DNA repair protein (Protein is coded in complementary strand; from 561184 to 560132)