Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 5178898
End position: 5178921
Length: 24

DNA sequence
>NC_023150, from 5178898 to 5178921 (24 bp); Rhodococcus pyridinivorans SB3094 ACCGCCACCGCGACCACCACTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 5178247-5178918	Sequence	Y013_24410 - deoxyribonuclease (Protein is coded in complementary strand; from 5178918 to 5178247)