Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 5073439
End position: 5073462
Length: 24

DNA sequence
>NC_023150, from 5073439 to 5073462 (24 bp); Rhodococcus pyridinivorans SB3094 TCCGGTTCCGGCTCTGGTTCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5073388-5074215	Sequence	Y013_23925 - hypothetical protein (Protein is coded in complementary strand; from 5074215 to 5073388)