Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 4896991
End position: 4897017
Length: 27

DNA sequence
>NC_023150, from 4896991 to 4897017 (27 bp); Rhodococcus pyridinivorans SB3094 CCCGGTGCCCCCGGTGCCCCCGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4895842-4897029	Sequence	Y013_23115 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 4897029 to 4895842)