Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 4785757
End position: 4785780
Length: 24

DNA sequence
>NC_023150, from 4785757 to 4785780 (24 bp); Rhodococcus pyridinivorans SB3094 GCGGCGGCGCCGGTGGCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4785025-4785987	Sequence	Y013_22585 - branched-chain amino acid ABC transporter permease (Protein is coded in complementary strand; from 4785987 to 4785025)