Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 4668820
End position: 4668846
Length: 27

DNA sequence
>NC_023150, from 4668820 to 4668846 (27 bp); Rhodococcus pyridinivorans SB3094 GGCGGCGACTGCGGCGACGACGGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4668056-4668865	Sequence	Y013_22005 - hypothetical protein (Protein is coded in complementary strand; from 4668865 to 4668056)