Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 4648397
End position: 4648420
Length: 24

DNA sequence
>NC_023150, from 4648397 to 4648420 (24 bp); Rhodococcus pyridinivorans SB3094 TCGTCGTCTTCGTCCTCGTCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4648373-4648642	Sequence	Y013_21915 - exodeoxyribonuclease (Protein is coded in complementary strand; from 4648642 to 4648373)