Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 464605
End position: 464649
Length: 45

DNA sequence
>NC_023150, from 464605 to 464649 (45 bp); Rhodococcus pyridinivorans SB3094 CTGCATGTTCGAGCACTGCATGTTCGAGCACTGCATGTTCGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 464535-465191	Sequence	Y013_02235 - hypothetical protein (Protein is coded in complementary strand; from 465191 to 464535)