Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 4390226
End position: 4390294
Length: 69

DNA sequence
>NC_023150, from 4390226 to 4390294 (69 bp); Rhodococcus pyridinivorans SB3094 CATCACGTCTCGGGCGGGAACGCTGTCACACCTCGGGCGGGAACGCTGTCACACCTCGGGCGGGAACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4390275-4391216	Sequence	Y013_20620 - beta-lactamase (Protein is coded in complementary strand; from 4391216 to 4390275)