Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 4100485
End position: 4100529
Length: 45

DNA sequence
>NC_023150, from 4100485 to 4100529 (45 bp); Rhodococcus pyridinivorans SB3094 ATGGTCGGCCACGGAATGTCGGGCCACGGAATGTCCGGCCAGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4100296-4101003	Sequence	Y013_19215 - hypothetical protein (Protein is coded in complementary strand; from 4101003 to 4100296)