Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 4067786
End position: 4067815
Length: 30

DNA sequence
>NC_023150, from 4067786 to 4067815 (30 bp); Rhodococcus pyridinivorans SB3094 CGCTGCCGCTGCCGCTGCCGCTGCCGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4067578-4068573	Sequence	Y013_19045 - hypothetical protein (Protein is coded in complementary strand; from 4068573 to 4067578)