Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 3951595
End position: 3951619
Length: 25

DNA sequence
>NC_023150, from 3951595 to 3951619 (25 bp); Rhodococcus pyridinivorans SB3094 CGCGGCGGGGTGCGGCGTGGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3951585-3952100	Sequence	Y013_18485 - membrane protein (Protein is coded in complementary strand; from 3952100 to 3951585)