Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 386435
End position: 386479
Length: 45

DNA sequence
>NC_023150, from 386435 to 386479 (45 bp); Rhodococcus pyridinivorans SB3094 GCGGCCGCCTTCTTCGCGGGGGCCTTCTTCGCAGCGGTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 385232-386605	Sequence	Y013_01835 - RNA polymerase sigma factor (Protein is coded in complementary strand; from 386605 to 385232)