Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 3715443
End position: 3715487
Length: 45

DNA sequence
>NC_023150, from 3715443 to 3715487 (45 bp); Rhodococcus pyridinivorans SB3094 GGTTGCGGGTTCGAGGGTTGCGGGTTCGACGGCGACGGGTTCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3714858-3717002	Sequence	Y013_17395 - Csp protein (Protein is coded in complementary strand; from 3717002 to 3714858)