Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 36332
End position: 36376
Length: 45

DNA sequence
>NC_023150, from 36332 to 36376 (45 bp); Rhodococcus pyridinivorans SB3094 TTCGTCCCCTGCCCTGTCGTCCCCTACCCTGTCGTTCTCTGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 36309-36791	Sequence	Y013_00175 - anti-sigma regulatory factor (Protein is coded in complementary strand; from 36791 to 36309)