Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 3492611
End position: 3492634
Length: 24

DNA sequence
>NC_023150, from 3492611 to 3492634 (24 bp); Rhodococcus pyridinivorans SB3094 CGGCGGCGGTGGCGGTGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3492489-3493538	Sequence	Y013_16300 - hypothetical protein (Protein is coded in complementary strand; from 3493538 to 3492489)