Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 3466068
End position: 3466094
Length: 27

DNA sequence
>NC_023150, from 3466068 to 3466094 (27 bp); Rhodococcus pyridinivorans SB3094 AGACCTCGTTGACCTCGTTGACCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3465542-3466720	Sequence	Y013_16145 - acyl-CoA dehydrogenase (Protein is coded in complementary strand; from 3466720 to 3465542)