Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 334379
End position: 334438
Length: 60

DNA sequence
>NC_023150, from 334379 to 334438 (60 bp); Rhodococcus pyridinivorans SB3094 TAGATCAGGCGCGTGCCGCTGTGATCAGAAGCGTGCCGCTGTGATCAGGAGCGTGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 334424-336514	Sequence	Y013_01590 - PTS lactose transporter subunit IIC (Protein is coded in complementary strand; from 336514 to 334424)