Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 3334799
End position: 3334843
Length: 45

DNA sequence
>NC_023150, from 3334799 to 3334843 (45 bp); Rhodococcus pyridinivorans SB3094 GGTCGAGGCATCGGGAGTCGAGTCCTCGGGAGTCGAGGCATCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3334260-3335402	Sequence	Y013_15425 - glycosyl transferase family 1 (Protein is coded in complementary strand; from 3335402 to 3334260)