Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 3332835
End position: 3332888
Length: 54

DNA sequence
>NC_023150, from 3332835 to 3332888 (54 bp); Rhodococcus pyridinivorans SB3094 GGCGCGGACTCGGCCTGCGGCGCGGACTGTGCCTGCGGAGCCGACTCGCCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3332706-3333362	Sequence	Y013_15410 - hypothetical protein (Protein is coded in complementary strand; from 3333362 to 3332706)