Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 3307920
End position: 3307964
Length: 45

DNA sequence
>NC_023150, from 3307920 to 3307964 (45 bp); Rhodococcus pyridinivorans SB3094 GCCCGCCGAACCCCCGCCCTCCGGACCCCCGCCCTCCGAAGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3307912-3308139	Sequence	Y013_15290 - hypothetical protein (Protein is coded in complementary strand; from 3308139 to 3307912)