Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 3196769
End position: 3196804
Length: 36

DNA sequence
>NC_023150, from 3196769 to 3196804 (36 bp); Rhodococcus pyridinivorans SB3094 GCCGCGCCGATCCCCGAGCCGATCGCCGCGCCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3196382-3198400	Sequence	Y013_14940 - hypothetical protein (Protein is coded in complementary strand; from 3198400 to 3196382)