Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 3164122
End position: 3164145
Length: 24

DNA sequence
>NC_023150, from 3164122 to 3164145 (24 bp); Rhodococcus pyridinivorans SB3094 GACGGCGAGGGCGACGGGGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3163817-3164356	Sequence	Y013_14770 - orotate phosphoribosyltransferase (Protein is coded in complementary strand; from 3164356 to 3163817)