Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 3046076
End position: 3046099
Length: 24

DNA sequence
>NC_023150, from 3046076 to 3046099 (24 bp); Rhodococcus pyridinivorans SB3094 GGTGACGGTGGCGGTGGCGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3045972-3046613	Sequence	Y013_14180 - superoxide dismutase (Protein is coded in complementary strand; from 3046613 to 3045972)