Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2950449
End position: 2950484
Length: 36

DNA sequence
>NC_023150, from 2950449 to 2950484 (36 bp); Rhodococcus pyridinivorans SB3094 GCGGCGAACGACGCGGCGAACGACGCGGCGAGCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2950044-2951468	Sequence	Y013_13705 - fusaric acid resistance protein (Protein is coded in complementary strand; from 2951468 to 2950044)