Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2909906
End position: 2909929
Length: 24

DNA sequence
>NC_023150, from 2909906 to 2909929 (24 bp); Rhodococcus pyridinivorans SB3094 GCGACGGGGACGGCCACGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2909129-2909971	Sequence	Y013_13515 - extradiol ring-cleavage dioxygenase III subunit B