Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2687998
End position: 2688042
Length: 45

DNA sequence
>NC_023150, from 2687998 to 2688042 (45 bp); Rhodococcus pyridinivorans SB3094 GCGAGGCCGACGGGGTCCAGGCCGACAGGGTCCAGGCCGACGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2686823-2687998	Sequence	Y013_12465 - MFS transporter
ORF. 2687968-2688945	Sequence	Y013_12470 - hydrolase (Protein is coded in complementary strand; from 2688945 to 2687968)