Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2441637
End position: 2441681
Length: 45

DNA sequence
>NC_023150, from 2441637 to 2441681 (45 bp); Rhodococcus pyridinivorans SB3094 GGTCGAGGCATCGGGAGTCGAGTCCTCGGGAGTCGAGGCATCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2441098-2442240	Sequence	Y013_11305 - glycosyl transferase family 1 (Protein is coded in complementary strand; from 2442240 to 2441098)