Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2439673
End position: 2439726
Length: 54

DNA sequence
>NC_023150, from 2439673 to 2439726 (54 bp); Rhodococcus pyridinivorans SB3094 GGCGCGGACTCGGCCTGCGGCGCGGACTGTGCCTGCGGAGCCGACTCGCCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2439544-2440200	Sequence	Y013_11290 - hypothetical protein (Protein is coded in complementary strand; from 2440200 to 2439544)