Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2414758
End position: 2414802
Length: 45

DNA sequence
>NC_023150, from 2414758 to 2414802 (45 bp); Rhodococcus pyridinivorans SB3094 GCCCGCCGAACCCCCGCCCTCCGGACCCCCGCCCTCCGAAGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2414750-2414977	Sequence	Y013_11170 - hypothetical protein (Protein is coded in complementary strand; from 2414977 to 2414750)