Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2270960
End position: 2270983
Length: 24

DNA sequence
>NC_023150, from 2270960 to 2270983 (24 bp); Rhodococcus pyridinivorans SB3094 GACGGCGAGGGCGACGGGGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2270655-2271194	Sequence	Y013_10650 - orotate phosphoribosyltransferase (Protein is coded in complementary strand; from 2271194 to 2270655)