Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 219973
End position: 220002
Length: 30

DNA sequence
>NC_023150, from 219973 to 220002 (30 bp); Rhodococcus pyridinivorans SB3094 ATCGCGCCCGATCGTGCGCGTCCGCGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 219025-220026	Sequence	Y013_01030 - hypothetical protein (Protein is coded in complementary strand; from 220026 to 219025)