Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2055884
End position: 2055919
Length: 36

DNA sequence
>NC_023150, from 2055884 to 2055919 (36 bp); Rhodococcus pyridinivorans SB3094 GCCGGGGTCTTGGCGGCGGTCTTGGCCGGAGCCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2055833-2056747	Sequence	Y013_09580 - heparin-binding hemagglutinin (Protein is coded in complementary strand; from 2056747 to 2055833)