Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2033573
End position: 2033608
Length: 36

DNA sequence
>NC_023150, from 2033573 to 2033608 (36 bp); Rhodococcus pyridinivorans SB3094 CTCGGCGCGCTCGGCGCGCTCGGCGCGCTCGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2033481-2033735	Sequence	Y013_09455 - hypothetical protein (Protein is coded in complementary strand; from 2033735 to 2033481)