Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2031690
End position: 2031716
Length: 27

DNA sequence
>NC_023150, from 2031690 to 2031716 (27 bp); Rhodococcus pyridinivorans SB3094 CGTCGACGACGTCGTCGACGTCCACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2031206-2032387	Sequence	Y013_09445 - histidine kinase (Protein is coded in complementary strand; from 2032387 to 2031206)