Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2028064
End position: 2028117
Length: 54

DNA sequence
>NC_023150, from 2028064 to 2028117 (54 bp); Rhodococcus pyridinivorans SB3094 CCGTCTTCGACACCGTGTCCGTCTTCGACACCGTGTCCGTCTTCGACACCGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2027349-2028647	Sequence	Y013_09425 - hypothetical protein (Protein is coded in complementary strand; from 2028647 to 2027349)