Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 2004218
End position: 2004241
Length: 24

DNA sequence
>NC_023150, from 2004218 to 2004241 (24 bp); Rhodococcus pyridinivorans SB3094 CAGCACCAGCGCCAGCACGAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2003313-2004302	Sequence	Y013_09295 - cytochrome C assembly protein (Protein is coded in complementary strand; from 2004302 to 2003313)