Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1825759
End position: 1825794
Length: 36

DNA sequence
>NC_023150, from 1825759 to 1825794 (36 bp); Rhodococcus pyridinivorans SB3094 CCCCAACCGCGCCGACAACCGCGCCACCAACCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1821620-1827427	Sequence	Y013_08665 - peptide synthetase (Protein is coded in complementary strand; from 1827427 to 1821620)