Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1715351
End position: 1715374
Length: 24

DNA sequence
>NC_023150, from 1715351 to 1715374 (24 bp); Rhodococcus pyridinivorans SB3094 GCGGCGGTGGCGGCGGCGACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1713860-1715440	Sequence	Y013_08195 - DNA-directed DNA polymerase (Protein is coded in complementary strand; from 1715440 to 1713860)