Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1483894
End position: 1483935
Length: 42

DNA sequence
>NC_023150, from 1483894 to 1483935 (42 bp); Rhodococcus pyridinivorans SB3094 CCGCACTCTTCGCCCCACCCTCTTCGCCCCGCCCTCTTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1483100-1483900	Sequence	Y013_07065 - fructosamine kinase (Protein is coded in complementary strand; from 1483900 to 1483100)