Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1464067
End position: 1464093
Length: 27

DNA sequence
>NC_023150, from 1464067 to 1464093 (27 bp); Rhodococcus pyridinivorans SB3094 GCCGCCGGTGCCACCGGTACCGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1463231-1466506	Sequence	Y013_06975 - arabinosyltransferase (Protein is coded in complementary strand; from 1466506 to 1463231)