Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1412803
End position: 1412826
Length: 24

DNA sequence
>NC_023150, from 1412803 to 1412826 (24 bp); Rhodococcus pyridinivorans SB3094 CACGGCGACGGCGACGGCCACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1412177-1413382	Sequence	Y013_06760 - potassium transporter (Protein is coded in complementary strand; from 1413382 to 1412177)